Theabrownin Inhibits Glioma Cell Growth via Apoptosis and Cell Cycle Arrest

Abstract

Theabrownin (TB), a natural compound present in the fresh leaves of green tea, is a potential antitumor agent. However, so far whether and how TB affects glioma is unclear. In this study, we investigated the effect of TB on astroglioma and oligodendroglioma cells. Surprisingly, TB significantly reduced the viabilities of HOG and U251 cells in a dose-dependent manner, which was accompanied by the upregulation of active-Casp-3, Bax, and PTEN; meanwhile, the antiapoptotic gene Bcl-2 was downregulated. In addition, TB treatment induced cell cycle arrest at the G1 and G2/M phases in HOG and U251 cells, respectively. TB treatment caused the downregulating of c-myc, cyclin D, CDK2, and CDK4 and upregulating of p21 and p27 in the HOG cell, while TB increased P53, p21, and p27 levels and decreased the levels of cell cycle regulator proteins such as CDK and cyclin A/B in the U251 cells. Therefore, the c-myc- and P53-related mechanisms were proposed for cell cycle arrest in these two glioma cell lines, respectively. Overall, our findings indicated that TB could be a novel candidate drug for the treatment of gliomas.

Introduction

Gliomas are specialized tumors arising from glial cells in the central nervous system (CNS), which can be divided into astrogliomas, oligodendrogliomas, and mixed oligoastrocytomas. Generally, these gliomas are classified into different grades based on the growth rates: grade I tumors such as pilocytic astrocytomas and more common infiltrating gliomas; grade II oligodendrogliomas and astrocytomas; grade III anaplastic oligodendrogliomas, anaplastic astrocytomas, and anaplastic oligoastrocytomas; and grade IV glioblastomas (GBM). Glioma is one of the most challenging cancers to manage with a relative 5-year survival rate of about 5%. Despite the variety of modern therapies against GBM, it is still a deadly disease with extremely poor prognosis. Patients usually have a median survival of approximately 14 to 15 months after diagnosis. The high fatality rates and low survival rates of glioma make it one of the deadliest and incurable cancers. Besides surgery, the widely used radiotherapy and chemotherapy have some limitations in cancer chemotherapy including the high cost of treatment, multidrug resistance, and cytotoxicity to healthy tissues. Therefore, it is urgent to seek for more effective and low toxic agents for the glioma treatment.

Natural compounds (e.g., alkaloids, terpenoids, flavonoids, and polyphenols) are less toxic and exhibit diverse biological activities, which are turning popular in the field of drug discovery. Green tea produced from the fresh leaves of Camellia sinensis (L.) O. Kuntze (Theaceae) is a traditional and commonly consumed nonalcoholic beverage in the world. Green tea has been reported to possess antioxidant, anti-inflammatory, antiproliferative, and antiangiogenic effects, which are beneficial for the prevention and treatment of various forms of diseases. To be noted, the anticancer effect of green tea has been evidenced by multiple studies. Theabrownin (TB), theaflavin (TF), and thearubigin (TR) are three main tea pigments determining the color, taste, and the bioactivity of the tea liquor. TB, as a main tea pigment, is a brown pigment with multiple aromatic rings and attached residues of polysaccharides and proteins. The major functional groups in TB are carboxyl, hydroxyl, amino, and methyl. TB comprises a family of macromolecules transformed from polyphenols and is considered superior to TF or TR in physicochemical and medicinal properties. Previous studies demonstrated that TB possessed strong antiproliferative, proapoptotic, and cell cycle–arresting effects on human osteosarcoma and lung carcinoma. In view of the TB’s key role in green tea, it can be expected that TB has a certain anticancer potential. However, the effect of TB on the glioma is lacking evidence.

In this study, we employed human glioma cell lines including astrocyte and oligodendrocyte cell-type glioma (A172, U87, U251, and HOG) to evaluate the effect of TB on these cell models and dissect the underling mechanisms. We found that TB significantly reduced the viabilities of HOG and U251 cells in a dose-dependent manner and induced cell cycle arrest at G1 and G2/M phases in HOG and U251 cells, respectively. Our results provide a promising candidate of natural products for glioma treatment.

Materials and Methods

Cell Line and Culture

Human glioma cell lines (A172, U87, U251, and HOG) were applied in this study. All cell lines were cultured in DMEM containing 10% FBS at 37°C in a humidified 5% CO 2 incubator. The medium was replaced daily, and the cells were treated with TB in different concentrations (0, 5, 25, 50, 100, 150, 200, and 300 μg/mL).

Cell lineCell typeGenusMethod used to generate cell lines
A172AstrocyteHumanClone derived from a surgically removed solid glioblastoma
U87AstrocyteHumanClone derived from a surgically removed malignant astrocytoma
U251AstrocyteHumanDerived from a malignant glioblastoma tumor
HOGOligodendrocyteHumanClone derived from a surgically removed human oligodendroglioma

Human glioma cell lines used in this study.

Cell Viability Assay

The viability of glioma cells (A172, U87, U251, and HOG) upon exposure to TB was determined by CCK-8 assay, according to the provider’s instructions. In brief, cells were seeded in 96-well microplates and grown in the cell culture media (100 μL/well) at a density of 5 × 10 3 cell/ml for 48 h. Afterward, the cells were incubated with TB solutions with different concentrations for 48 and 72 h, respectively. The samples were washed once with the incomplete cell culture media to remove the residual TB, followed by adding 10 μL of CCK-8 reagents and 100 μL of incomplete cell culture media to each well to allow the cells to grow for another 1 h in a 5% CO 2-humidified atmosphere at 37°C. Finally, the microplates were analyzed with a microplate reader, and the absorbance value at 450 nm (OD 450) for each well was measured. The viability of cells was expressed as the percentage of the cell survival rate between the experimental group and the control group. The value for each treatment represents the averaged value taken from three replicate wells in three independent experiments.

Cell Morphology and DAPI Staining

The TB-treated HOG and U251 cells at 24 h were washed with phosphate-buffered saline (PBS) thrice and fixed with 4% paraformaldehyde in PBS for 30 min at room temperature. Then, the cells were permeabilized with 0.5% Triton X-100 in PBS for 10 min. An aliquot of the cells was mounted using a ProLong® Diamond Antifade Mountant with DAPI in the dark. The stained cells were observed under a fluorescence microscope. Three coverslips were used as replicates of each group, and the apoptotic nuclei of the cells were visualized.

Cell Cycle Analysis

Cell cycle analysis was performed with flow cytometry. In brief, U251 and HOG cells were cultured on six-well plates with a density of 3 × 10 5 cells/well for 24 h, followed by TB treatment for 72 h. The cells were harvested and washed with PBS thrice and suspended in cold phosphate-buffered saline. Cells were then stained with PI/RNase staining solution (20 μg/ml PI and 10 μg/ml DNase-free RNase) at 37°C in the dark for 30 min. The cell cycle was analyzed in triplicate using flow cytometry.

Real-Time PCR Analysis

After TB treatment, the gene expression in HOG and U251 cells was detected by using real-time PCR assay on an ABI QuantStudio TM 7 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, United States). The total RNA of the cells in each group was extracted using Trizol reagent and converted to cDNA via reverse transcription. At the end of each reaction, a melting curve analysis was performed. β-actin was used as the reference gene, and the 2−ΔΔCT method was applied to analyze the relative expression of each gene.

GeneForward primerReverse primer
Caspase-3GACTGCGGTATTGAGACAGACGAGTGAGGATGTGCATGAA
Bcl-2AACATCGCTCTGTGGATGACGAGCAGCGTCTTCAGAGACA
BaxGAATTGGCGATGAACTGGACGCAAAGTAGAAAAGGGCACC
P27TGGAAAGCGGTCTGCAAGTGTCACTGTCACATTCAGGGGC
P21GGATGTCCGTCAGAACCCATCCCTCCAGTGGTGTCTCGGTG
PTENCCGAAAGGTTTTGCTACCATTCTAAAATTATTTCCCTTTCTGAGCATTCC

Primer sequences used for qPCR.

Western Blot Analysis

Following TB treatment, HOG and U251 cells were harvested and washed twice with cold PBS. Then, the cells were lysed with radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitor and phosphatase inhibitor for 30 min on ice, with repeated freezing and thawing for three times. The lysates were then sonicated and centrifuged at 12,000 rpm for 15 min at 4°C to obtain the total protein supernatant. Protein concentrations were determined by a commercial BCA kit. Appropriately 20 μg of lysed protein was boiled in sample-loading buffer and separated by a denaturing 10% SDS-PAGE. The gels were transferred onto polyvinylidene fluoride membranes and blocked with 5% nonfat milk for 1.5 h, followed by overnight incubation at 4°C with the following primary antibodies: c-Myc, cyclin A1, cyclin B1, cyclin D1, P53, p-P53, Cdk1, Cdk2, Cdk4, AKT, p-AKT, Erk, p-Erk, active caspase-3, Bax, Bcl-2, PTEN, and GAPDH. Following the incubation with peroxidase-conjugated goat anti-rabbit IgG or anti-mouse IgG at room temperature for 1 h, the membrane was visualized using BeyoECL Star, and pictures were taken using a ChemiDoc imaging system.

Measurement of Apoptosis

The apoptotic assay was performed using an annexin V-FITC apoptosis detection kit according to the manufacturer’s protocol. For the flow cytometric analysis, cells were harvested with 0.05% trypsin with EDTA, washed twice with cold PBS, and resuspended in 500 μL binding buffer supplied by the manufacturer. The cells were then incubated with 5 μL annexin V-FITC (40 μg/mL) and 5 μL propidium iodide (PI) (40 μg/mL) in the dark for 10 min. Analysis was performed using a BD FACSAria TM flow cytometer set at an excitation wavelength of 488 nm and an emission wavelength of 605 nm.

TUNEL Assay

Cells were planted into 48-well plates. After 24 h, cells were treated with TB (0, 25, and 50 μg/mL) at 37°C in a humidified 5% CO 2 for 24 h. Apoptosis was evaluated using a TUNEL FITC Apoptosis Detection Kit according to the manufacturer’s protocol. In brief, cells were incubated with 20 μg/ml proteinase K for 20 min at room temperature and washed in PBS. The sections were then incubated with terminal deoxynucleotidyl transferase and FITC-12-dUTP at 37°C for 1 h. Finally, the sections were washed in PBS three times and counterstained with DAPI. Images of TUNEL staining were acquired with a fluorescence microscope.

Statistical Analysis

For each analysis, results from independent TB were treated as biological replicates (n ≥ 3). Quantitative data were presented as mean ± SD. Statistical significance was evaluated by Student’s t-test. Differences were considered statistically significant at *p< 0.05, **p< 0.01, and ***p< 0.001 (n.s.: no significant difference).

Results

TB Inhibits Cell Viability of Glioma Cells

We treated four human glioma cell lines and primary cultured astrocyte with various concentrations (0–300 μg/ml) of TB and conducted cell viability by using CCK-8 assay at 48 and 72 h. We found that TB treatment caused an obvious inhibition of the cell survival rate of four glioma cells at various concentrations. The inhibitory effect was at a dose- and time-dependent manner of TB treatment. After TB treatment for 48 h, the IC 50 values declined to 268, 124, 36, and 26 μg/ml for A172, U87, U251, and HOG cells, respectively.

Tin liên quan